Shared by Downes Lab (Saint Louis University)

Plasmid Name pACT2.2gtwy+UBC8* C85S
Alt Name/ID p117
Backbone pACT2.2gtwy
Backbone Size 8187
Gene/Insert UBC8* C85S
Alt Insert Name At5g41700
Insert Size 447
Species A. thaliana (mustard weed)
GenBank IDs DQ027022
Entrez Gene ID UBC8 (Arabidopsis thaliana) (AT5G41700, ARABIDOPSIS THALIANA UBIQUITIN CONJUGATING ENZYME 8, ATUBC8, MBK23.24, MBK23_24, UBIQUITIN CONJUGATING ENZYME, UBIQUITIN CONJUGATING ENZYME 8)
Mutations/Deletions C85S
Tag 1 (e.g. GFP, HA) GAL4 AD
Location of Tag 1 N terminal on backbone
5' Sequence Primer CTCTATGGCTTACCCATACGATGTTCC
Bacterial Resistance Ampicillin
Selectable Marker LEU2
Plasmid Sequence View Sequence
Source Created in Lab
Source, Specify R. Tague 09.09.07
Notes Product of Site-directed Mutagenesis (Stratagene) on pACT2.2Gtwy+UBC8* (p87) using primers 234 and 235. Sequenced Correct 09.10.07.
Attachments
Print Page
Also shared by Downes Lab