Shared by Downes Lab (Saint Louis University)

Plasmid Name pACT2.2gtwy+UBC36*
Alt Name/ID p114
Backbone pACT2.2gtwy
Backbone Size 8187
Gene/Insert UBC36*
Alt Insert Name At1g16890
Insert Size 462
Species A. thaliana (mustard weed)
GenBank IDs DQ027049
Entrez Gene ID UBC36 (Arabidopsis thaliana) (AT1G16890, F17F16.19, UBC13B, UBIQUITIN CONJUGATING ENZYME 13B, UBIQUITIN-CONJUGATING ENZYME 36)
Tag 1 (e.g. GFP, HA) GAL4 AD
Location of Tag 1 N terminal on backbone
5' Sequence Primer CTCTATGGCTTACCCATACGATGTTCC
Bacterial Resistance Ampicillin
Selectable Marker LEU2
Plasmid Sequence View Sequence
Source Created in Lab
Source, Specify RTT
Print Page
Also shared by Downes Lab