Shared by Downes Lab (Saint Louis University)

Plasmid Name pACT2.2gtwy+UBC18*
Alt Name/ID p097
Backbone pACT2.2gtwy
Backbone Size 8187
Gene/Insert UBC18*
Alt Insert Name At5g42990
Insert Size 486
Species A. thaliana (mustard weed)
GenBank IDs DQ027032
Entrez Gene ID UBC18 (Arabidopsis thaliana) (AT5G42990, MBD2.19, MBD2_19, ubiquitin-conjugating enzyme 18)
Tag 1 (e.g. GFP, HA) GAL4 AD
Location of Tag 1 N terminal on backbone
5' Sequence Primer CTCTATGGCTTACCCATACGATGTTCC
Bacterial Resistance Ampicillin
Selectable Marker LEU2
Plasmid Sequence View Sequence
Source Created in Lab
Source, Specify RTT
Print Page
Also shared by Downes Lab