Shared by Downes Lab (Saint Louis University)

Plasmid Name pACT2.2gtwy+UBC16*
Alt Name/ID p095
Backbone pACT2.2gtwy
Backbone Size 8187
Gene/Insert UBC16*
Alt Insert Name At1g75440
Insert Size 486
Species A. thaliana (mustard weed)
GenBank IDs DQ027030
Entrez Gene ID UBC16 (Arabidopsis thaliana) (AT1G75440, F1B16.3, F1B16_3, ubiquitin-conjugating enzyme 16)
Tag 1 (e.g. GFP, HA) GAL4 AD
Location of Tag 1 N terminal on backbone
5' Sequence Primer CTCTATGGCTTACCCATACGATGTTCC
Bacterial Resistance Ampicillin
Selectable Marker LEU2
Plasmid Sequence View Sequence
Source Created in Lab
Source, Specify RTT
Print Page
Also shared by Downes Lab