Shared by Downes Lab (Saint Louis University)

Plasmid Name pACT2.2gtwy+UBC9*
Alt Name/ID p088
Backbone pACT2.2gtwy
Backbone Size 8187
Gene/Insert UBC9*
Alt Insert Name At4g27960
Insert Size 537
Species A. thaliana (mustard weed)
GenBank IDs DQ027023
Entrez Gene ID UBC9 (Arabidopsis thaliana) (AT4G27960, T13J8.70, T13J8_70, UBIQUITIN CONJUGATING ENZYME 9, UBIQUITIN-PROTEIN LIGASE)
Tag 1 (e.g. GFP, HA) GAL4 AD
Location of Tag 1 N terminal on backbone
5' Sequence Primer CTCTATGGCTTACCCATACGATGTTCC
Bacterial Resistance Ampicillin
Selectable Marker LEU2
Plasmid Sequence View Sequence
Source Created in Lab
Source, Specify RTT
Print Page
Also shared by Downes Lab