Shared by Downes Lab (Saint Louis University)

Plasmid Name pACT2.2gtwy+UBC29*
Alt Name/ID p107
Backbone pACT2.2gtwy
Backbone Size 8187
Gene/Insert UBC29*
Alt Insert Name At2g16740
Insert Size 447
Species A. thaliana (mustard weed)
GenBank IDs DQ027042
Entrez Gene ID UBC29 (Arabidopsis thaliana) (AT2G16740, T24I21.15, T24I21_15, ubiquitin-conjugating enzyme 29)
Tag 1 (e.g. GFP, HA) GAL4 AD
Location of Tag 1 N terminal on backbone
5' Sequence Primer CTCTATGGCTTACCCATACGATGTTCC
Bacterial Resistance Ampicillin
Selectable Marker LEU2
Plasmid Sequence View Sequence
Source Created in Lab
Source, Specify RTT
Print Page
Also shared by Downes Lab